Skip to main content

Table 2 Sequences of primers used in the real-time PCR

From: In vivo experimental intervertebral disc degeneration induced by bleomycin in the rhesus monkey

Name GeneBank accession No.   Sequence (5′-3′)
GAPDH XM_001091567.2 Forward ACAATCCCATCACCATCTCGC
   Reverse GACCCTTTTGGCCTCCTCATC
Aggrecan XM_002804944.1 Forward ACTCGCTGAGTGTCAGCATC
   Reverse ACACACGGCTCCACTTGATT
Col1α1 XM_001096194.2 Forward CCAGCCGCAAAGAGTCTACA
   Reverse TGGTGGGATGTCTTCGTCTTG
Col2α1 XM_001100559.2 Forward GTGTCAGGGCCAGGATGTC
   Reverse AGGGGCACCTTTTTCACCTT
MMP-3 XM_001098400.2 Forward GGCGCAAATCTCTCAGGAAG
   Reverse GGCCCAGAACTGATTTCCTTT
ADAMTS-5 XM_001103439.2 Forward GTGGCTCACGAAATCGGACA
   Reverse GGTGGCTGAAGTGCATTTGG
vWF NM_001243086.1 Forward GAGGGTGGTTGGTGGATGTC
   Reverse CTAGGCCATGCTCCTAGCTG
TNF-α NM_001047149 Forward CCCCAAGGACCCCTCTCTAA
   Reverse GGGTTTGCTACAACATGGGC
IL-1β NM_001042756 Forward GACGTCGATGGCCCTAAACA
   Reverse AAGCCCTCGTTGTAGTGCTC
IL-6 NM_001042733 Forward GGTACATCCTCGACGGCATC
   Reverse CCAGGCAAGTGTCCTCATTG
Caveolin 1 NM_001168614 Forward ACGTAGACTCGGAGGGACAT
   Reverse AGCGATGGTGATTCCCCAAG
TGF β1 XM_001100842 Forward GGGCTACCATGCCAACTTCT
   Reverse CCAGGACCTTGCTGTACTGT