Skip to main content

Advertisement

Table 1 List of primers used in the real-time PCR analysis of gene expression in C3H10T1/2 cells

From: Effects of culture on PAMPS/PDMAAm double-network gel on chondrogenic differentiation of mouse C3H10T1/2 cells: in vitro experimental study

Primer ID Primers (5′-3′) Amplicon size (bp) Accession No.
Aggrecan–F AGTGGATCGGTCTGAATGACAGG 105 NM007424
Aggrecan–R TTG GCA GCG TTC ATG TCG TAA
Collagen type I–F ATGCCGCGACCTCAAGATG 153 NM007742
Collagen type I–R TGAGGCACAGACGGCTGAGTA
Collagen type II–F AGGGCAACAGCAGGTTCACATAC 171 NM031163
Collagen type II–R TGTCCACACCAAATTCCTGTTCA
SOX9-F CAGTACCCGCATCTGCAC 81 NM011448
SOX9-R TCTCTTCTCGCTCTCGTT
Osteocalcin-F CTCTGTCTCTCTGACCTCACAG 133 NM031368
Osteocalcin -R GGAGCTGCTGTGACATCCATAC
GAPDH-F TGTGTCCGTCGTGGATCTGA 150 NM001001303
GAPDH-R TTGCTGTTGAAGTCGCAGGAG