Skip to main content

Table 1 Sequences of primers (5’-3’)

From: Regulation of ubiquitin-proteasome and autophagy pathways after acute LPS and epoxomicin administration in mice

Gene Forward Reverse NCBI accession number
Cphn CGTCTCCTTCGAGCTGTTTG CCACCCTGGCACATGAATC NM_008907.1
MAFbx CCATCAGGAGAAGTGGATCTATGTT GCTTCCCCCAAAGTGCAGTA NM_026346.3
MuRF1 ACGACATCTTCCAGGCTGCGAATCC TCTCGTCTTCGTGTTCCTTGC NM_001039048.2
Psmb1 CTTGATGAAGAAGGAAAGGGAG TGGTTGTCGAGCAGAGGC NM_011185.3
Psmc2 GAAGGACGACAAGCCCATC AGGTGCCAACCCAGTGTCAG NM_011188.3
Rpl4 CGCAACATCCCTGGTATTACT TGTGCATGGGCAGGTTATAGT NM_024212.4
Tnf-α CAGACCCTCACACTCAGATCA CCTTGTCCCTTGAAGAGAACC NM_013693.3