Skip to main content

Table 1 Sequence of primers used for real-time PCR analysis

From: Quantitative T2 mapping to characterize the process of intervertebral disc degeneration in a rabbit model

Gene Sequence (5′-3′) Product size (bp)
Aggrecan F: TAAACCCGGTGTGAGAACCG 176
R: CCTGGGTGACAATCCAGTCC
Collagen II F: GGATAGACCCCAACCAAGGC 122
R: GCTGCTCCACCAGTTCTTCT
GAPDH F: GGAATCCACTGGCGTCTTCA 122
R: GGTTCACGCCCATCACAAAC