Skip to main content

Table 1 Oligonucleotide sequences for the specific primers used in real time PCR

From: High glucose concentration up-regulates the expression of matrix metalloproteinase-9 and -13 in tendon cells

GADPH  
  Sense: AGTCTACTGGCGTCTTCA
  Antisense: TTGTCATATTTCTCGTGGT
MMP-2  
  Sense: GGAAGCATCAAATCGGACTG
  Antisense: GGGCGGGAGAAAGTAGCA
MMP-8  
  Sense: GCCCGACTCTGGTGATTT
  Antisense: TGATGTCTGCTTCTCCCT
MMP-9  
  Sense: CCCACTTACTTTGGAAACG
  Antisense: GAAGATGAATGGAAATACGC
MMP-13  
  Sense: CCACCTTCTTCTTGTTGA
  Antisense: GCATTTCTCGGAGTCTAT
Type I collagen  
  Sense: TGGAGACAGGTCAGACCTG
  Antisense: TATTCGATGACTGTCTTGCC
Type III collagen  
  Sense: TAAAGGGTGAACGGGGCAGT
  Antisense: ACGTTCCCCATTATGGCCAC