Skip to main content

Table 1 Primer oligonucleotide sequences used for real time-PCR

From: Foxc2 regulates osteogenesis and angiogenesis of bone marrow mesenchymal stem cells

Gene Forward primer 5′-3′ Reverse primer 5′-3′
GAPDH CCACTTTGTGAAGCTCATTTCCT TCGTCCTCCTCTGGTGCTCT
Foxc2 CGCCTAAGGACCTGGTGAAG GGAAGCGGTCCATGATGA
OCN CCACCCGGGAGCAGTGT GAGCTGCTGTGACATCCATACTTG
Runx2 CCTTCCACTCTCAGTAAGAAGA TAAGTAAAGGTGGCTGGATAGT
VEGF GGCTCACTTCCAGAAACACG GTGCTCTTGCAGAATCTAGTGG
PDGF-β CTGCCCACAGCATGATGAGGATTGAT GCCAGGATGGCTGAGATCACCAC
CXCR4 GGTCTGGAGACTATGACTCC CACAGATGTACCTGTCATCC