Skip to main content

Table 2 PCR primers

From: Local biochemical and morphological differences in human Achilles tendinopathy: a case control study

mRNA Sense Primer Antisense Primer
Collagen 1 GGCAACAGCCGCTTCACCTAC GCGGGAGGACTTGGTGGTTTT
Collagen 3 CACGGAAACACTGGTGGACAGATT ATGCCAGCTGCACATCAAGGAC
Fibronectin TTTGCTCCTGCACATGCTTT TAGTGCCTTCGGGACTGGGTTC
Tenascin C CAACCATCACTGCCAAGTTCACAA GGGGGTCGCCAGGTAAGGAG
Fibromodulin CAGTCAACACCAACCTGGAGAACC TGCAGAAGCTGCTGATGGAGAA
Versican AGTCAGTGGAAGGCACGGCAATCT CCGTTAAGGCACGGGTTCATTT
Decorin GGTGGGCTGGCAGAGCATAAGT TGTCCAGGTGGGCAGAAGTCA
MMP-2 CCGCCTTTAACTGGAGCAAAAACA TTGGGGAAGCCAGGATCCATTT
MMP-9 AGCGAGGTGGACCGGATGTT AGAAGCGGTCCTGGCAGAAATAG
TIMP-1 CGGGGCTTCACCAAGACCTACA TGGTCCGTCCACAAGCAATGA
TIMP-2 CTCGCTGGACGTTGGAGGAAAG GTGTCCCAGGGCACGATGAAGT
CTGF TGCGAAGCTGACCTGGAAGAGA GCCGTCGGTACATACTCCACAGAA
bFGF TGACGGGGTCCGGGAGAAGA ATAGCCAGGTAACGGTTAGCACACAC
HGF TGAAATATGTGCTGGGGCTGAAA ACAAACAAGTGGGCCACCATAATCC
cMet AACCCGAATACTGCCCAGACCC TGATATCCGGGACACCAGTTCAG
VEGFA-1 ATGACGAGGGCCTGGAGTGTGT CTCCTATGTGCTGGCCTTGGTG
IGF-1 GACATGCCCAAGACCCAGAAGGA CGGTGGCATGTCACTCTTCACTC
TGFb-1 GAGGTCACCCGCGTGCTAATG CACGGGTTCAGGTACCGCTTCT
Cox-1 GGTTTGGCATGAAACCCTACACCT CCTCCAACTCTGCTGCCATCT
IL-1R GGAAGGGATGACTACGTTGGGGA CCAGCCAGCTGAAGCCTGATGTT
IL-1b TCCAGGGACAGGATATGGAGCA AGGCCCAAGGCCACAGGTATTT
KI67 CGGAAGAGCTGAACAGCAACGA GCGTCTGGAGCGCAGGGATA
CCL GCCCTTCTGTGCCTGCTGCT GCAGGTGACTGGGGCATTGATT
IL-6 GAGGCACTGGCAGAAAACAACC CCTCAAACTCCAAAAGACCAGTGATG
TNF-a TTCCCCAGGGACCTCTCTCTAATC GAGGGTTTGCTACAACATGGGCTAC
RPLP0 GGAAACTCTGCATTCTCGCTTCCT CCAGGACTCGTTTGTACCCGTTG
GAPDH CCTCCTGCACCACCAACTGCTT GAGGGGCCATCCACAGTCTTCT