Skip to main content

Table 1 Primer sequences, conditions and annealing temperature of PCR assay for aggrecan mRNA amplification

From: Characterization of microRNA expression profiles in normal and osteoarthritic human chondrocytes

Primers Sequence Length %GC Annealing Temperature Amplicon (bp)
AGG 1 F 5′ GCCTACGAAGCAGGCTATGA 3′ 20 mer 55 60°C 136
AGG 1R 5′ GCACGCCATAGGTCCTGA 3′ 18 mer 61   
HPRT 1 F 5′ TGACCTTGATTTATTTTGCATACC 3′ 24 mer 33 60°C 102
HPRT 1R 5′ CGAGCAAGACGTTCAGTCCT 3′ 20 mer 55