Skip to main content

Table 2 Details of the primer oligonucleotide sequences used for real-time PCR

From: The oncofetal gene survivin is re-expressed in osteoarthritis and is required for chondrocyte proliferation in vitro

Gene Forward primer 5'-3' Reverse primer 5'-3'
Survivin CTTGGCCCAGTGTTTCTTCT CCTCCCAAAGTGCTGGTATT
GAPDH CCCACTCCTCCACCTTTGAC CATACCAGGAAATGAGCTTGACAA
β-actin AGTCCTGTGGCATCCACGAAA GTCATACTCCTGCTTGCTGA
SOX9 CTGAGTCATTTGCAGTGTTTTCT CATGCTTGCATTGTTTTTGTGT
COL2A1 CATTGATGGGGAGGCGTGAG CATTGATGGGGAGGCGTGAG