Skip to main content

Table 1 real-time PCR investigation.

From: Characterization of the age-dependent intervertebral disc changes in rabbit by correlation between MRI, histology and gene expression

Gene (Abbreviation) Accession number (Gene Bank) Forward primer (5'-3') Reverse primer (5'-3') Product length
GAPDH NM_002046 agccacatcgctcagaca gcccaatacgaccaaatcc 66 pb
Type II collagen
COL2A1
D83228 acagcaggttcacctataccg cccacttaccggtgtgtttc 60 pb
Aggrecan
AGC1
L38480 gaggatggcttccaccagt tggggtacctgacagtctga 61 pb
Type I colagen
COL1A1
D49399 agcgatggtcctccaggt gccagggtaaccacgttct 63 pb
Matrix metalloproteinase 13
MMP13
NM_001082037 ttttgaagacacgggcaag tcatcatagctccagacttggtt 60 pb
Bone Morphogenic Protein 2
BMP2
NM_001082650 tgcagaacttcaggtttttcg tggaaaccgctgtcgtct 63 pb
Matrix Gla protein
MGP
D21265 tggatataatgctgcttacaatcg tttccaatcttattcagctctgc 64 pb
P21-activated protein kinase I
P21
NM_001082756 agaaagaaaaagaacgaccagaga cgtggatggtgtgctcaa 60 pb
  1. GenBank reference of the genes evaluated and oligonucleotide primers used for real-time PCR.