Skip to main content

Advertisement

Table 1 Gli3 primers for DGGE

From: The expression of Gli3, regulated by HOXD13, may play a role in idiopathic congenital talipes equinovarus

  Primer sequence Annealing Temp (°C) Product size (bp)
Promoter 1 F *AGCTTGCAGTTCCCTTGC 60 684
R GTCCGACAATTTCTAACATCGA   
Promoter 2 F *GCCTTCGATGTTAGAAATTGTCG 62 668
R TGGGCTGCTGGTAATCCCTGTGC   
Exon 1 F *TTTTGGAAAGTTGATGGCTCT 60 229
R GGCTGCTGGTAATCCCTGT   
Exon 2 F *AATTGCTCCTTAAAGTAGTT 60 335
R CATAGCTCCTGAACAAGTG   
Exon 3 F *CAATGTTGCTTTGTGAAT 60 234
R TAAAAGCCAGCATCTCGT   
Exon 4 F *CCCCTTGTATCTGGTTTT 57 316
R GTCTACTTTATACACGTCCC   
Exon5 F *ATTGCTGATGTGGGTTGT 60 297
R GTTGCCTTTGCCATTTCC   
Exon 6 F *TAGGCAAGTAGCAATAAATAG 60 303
R ACATAATGGATTCAGGAAAA   
Exon 7 F *GCTCAGCGTTTAAGTGAT 61 268
R GCATCGACCTGTCCCTCT   
Exon 8 F *GGGATTGGAGAATTATCAG 60 299
R AGTCTTGGGAGGAGTGGG   
Exon13 F *TTCCTTTCCACTTGACCCC 60 391
R AAAACCCTGAGCAGATGCA   
Exon 14-1 F *TGTGAGGCAGGCAATGTG 53 325
R GGAGAAGCAGGGCGAGAT   
Exon 14-2 F *ATCTCGCCCTGCTTCTCC 55 489
R GCTGCTGAGGCTGCTGAA   
Exon 14-3 F *AGAGGATGAGCCTGAAGACG 56 486
R GCTGCTCGTACCCTGCTT   
Exon 14-4 F *CTGATGCCAACCTGAACG 56 479
R TCCACTGGTGCCACTTCC   
Exon 14-5 F *TGGTCGTCCACCCGCAGAA 58 490
R GGCCCTTGGTAGATGTTGATGT   
Exon 14-6 F *AGATGCTTGGGCAGATTAG 60 350
R TGAACCAGCTTTCGTGTC   
Exon 14-7 F *CGCTGTGCTCTAATCTGC 60 491
R TATTGATTTCCGTTGGTTG   
  1. *GC clamp was added at the 5' end of the forward primers
  2. GC clamp: cgcccgccgcgccccgcgcccggcccgccgcccccgcccg